Thionin STS marker for barley genotype identification
Primetta Faccioli, Nicola Pecchioni and Valeria Terzi
Istituto sperimentale per la Cerealicoltura Sezione di
Fiorenzuola d'Arda - Via S. Protaso 302 - I-29017 Fiorenzuola
d'Arda (PC), Italy


Molecular markers could provide new and powerful tools to simplify barley varietal identification.

In a previous work (Pecchioni et al., 1993) it has been done fingerprinting of 47 varieties using RFLP markers generated after DNA digestion with four-cutter restriction enzymes. STS (sequence-tagged-sites) markers corresponding to B-hordein genes were used for fingerprinting of the same barley varieties and results were compared with those obtained using the traditional electrophoretic analysis of hordeins and observation of morpho-physiological traits (Faccioli et al., in press).

Aim of this work was to explore variability among 36 barley cultivar for another STS marker corresponding to DB4 CDNA (Bohlman et al., 1987), encoding for leaf thionin. Primer sequences used in this work were: 5' GGGTACAAATAGATTCATCGTG 3'; 5' GCACCCAGCAAGAGTATTAAGA 3'. Electrophoresis of digested products permitted to evidenciate 10 polymorphic major bands, that generated, among considered varieties, 16 different patterns (Fig. 1). There are characteristic patterns for eight varieties, while the other cultivars are grouped in eight classes (Tab. 1).

____________________________________________________________
| Table 1. Varieties and classes of varieties different    |
| for thionin STS pattern                                  |
|__________________________________________________________|
| - Igri                                                   |
| - Mirco                                                  |
| - Fleuret                                                |
| - Trebbia                                                |
| - Timura                                                 |
| - Marinka, Tipper                                        |
| - Formula, Elan, Carina                                  |
| - Roland, Aura, Cannon, Alpha                            |
| - Mette                                                  |
| - Protidor                                               |
| - Arda, Pilastro                                         |
| - Thibaut                                                |
| - Express, Fox, Kaskade                                  |
| - Hulda, Etrusco, Selvaggio, Gavotte, Atem, Robur, Tania |
| - Barberousse, Red, Flash, Havila                        |
| - Criter, Torrent, Maris Otter                           |
|__________________________________________________________|

We propose this STS marker as additional tools for barley cultivar fingerprinting purposes.

References

Bohlmann, H., and K. Apel. 1987. Isolation and characterization of cDNAs coding for leaf-specific thionins closely related to the endosperm-specific hordothionin of barley (Hordeum vulgare L.). Mol. Gen. Genet. 207: 446-454.

Faccioli, P., V. Terzi, A. Monetti, J. Nicola, and N. Pecchioni. B-hordein STSs markers for barley genotype identification:

comparison with RFLPS, hordein A-PAGE and morpho- physiological traits. Seed Sci. & Technol. In press.

Pecchioni, N., A.M. Stanca, V. Terzi, and L. Cattivelli. 1993. RFLP analysis of highly polymorphic loci in barley. Theor. Appl. Genet. 85: 926-930.

Figure 1. Example of patterns obtained after DNA amplification with thionin primers and double digestion (HaeIII, RsaI) of the amplified products (4=Barberousse; 47=Trebbia; 11=Express; 8=Criter; 21=Hulda; 41=Roland; 10=Etrusco; 42=Selvaggio; 15=Fox; 24=Kaskade; 39=Red).