GrainGenes Sequence Report: AL509420
Sequence
AL509420
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC178038
NCBI UniGene
Hv.2101
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, moderately similar to NP_001060122.1 Os07g0585000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Tissue
developing caryopsis (3.-15.DAP)
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
AL509420 Hordeum vulgare Barke developing caryopsis (3.-15.DAP) Hordeum vulgare subsp. vulgare cDNA clone HY01M05u 3', mRNA sequence.
Strain
lab_host XLOLR vulgare
Clone
HY01M05u
Probe
[Bcl1190ct1752cn5579] {SpCl-394}
Remark
DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http: Note: Vector: plasmid pBK-CMV; Site_1: EcoRI; Site_2: XhoI; mRNA was made from developing caryopsis (3.-15.DAP) of spring barley variety 'Barke', a high quality malting variety. Cloning sites: EcoRI (5'-end of cDNA) and XhoI (3'-end of cDNA). NOTE: Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRI adapter. Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp
DNA
gcgttatatccatcctcgagcccctcccgactctcagcctcaccctgccc
gctgctctctcctccgcgcctgattccagtggtgctgctgcttcttctca
aatctccaggacagaccagacacacacacagggacacagggtaagttgcg
gagcagctagcggcggaggtgctttcttcgtcatggagtcgcagcagcag
cagcagcagatggaggcggtttctgcgccggccgccgctacgaacggggg
cggggagctgatcgggtacgtggacgtgcacgtgcggagcgcgcgggaca
ttcagaacatctgcatctaccacaagcaggatgtgtacgcgcgcctgtcg
ctgccgggggagggcgcgccggcggcctccacgcaggtaatcaatggcgg
aggccgcaacccggtgtttgaccagtcggtg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: AL509420
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
