Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AL508105

[Submit comment/correction]

Sequence	AL508105
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC190314
NCBI UniGene	Hv.8291
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'CDNA clone: FLbaf1h12, mRNA sequence'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Tissue	developing caryopsis (3.-15.DAP)
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	AL508105 Hordeum vulgare Barke developing caryopsis (3.-15.DAP) Hordeum vulgare subsp. vulgare cDNA clone HY07M16V 5', mRNA sequence.
Strain	lab_host XLOLR vulgare
Clone	HY07M16V
Probe	[Bcl264ct610cn2493] {SpCl-309} AL508105
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http: Note: Vector: plasmid pBK-CMV; Site_1: EcoRI; Site_2: XhoI; mRNA was made from developing caryopsis (3.-15.DAP) of spring barley variety 'Barke', a high quality malting variety. Cloning sites: EcoRI (5'-end of cDNA) and XhoI (3'-end of cDNA). NOTE: Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRI adapter. Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp
DNA	gatttttttttttttttttaaaggttccagaaccgaaaaacattatctag ggcaaaacatcatccaaggtaatcgtctaaacaggaacactccttcagat tctggaaatggaccaacacagtaatggtagcaaagctatgcgggatcatt gagaagcttatcgcttcttggagacaccaacagtctttcctctcctgccg gtagtcttggtgtgctgaccacggacacgcacgccccagtagtgacgaag accacggtggttcctgatcttcttgagcctctcaaggtcgtccctgagct tcatgtcgacggcgttgganaccacctgggtgaacctgccgtccttgtag tccttcttcctgttaaggaaccagtccggcaccttgaactggcgcgggtt ggccacaaccgtcatcagccggtccatctcctccgaggagagctctccgg ccctcttgttcatgtcgatgtcggccttcttgcaggcgatgttggagaag cggcggcccacacccttgatggaggtcagcgcgaacatgatcttctgctt accatcgacgttggtgttgagcacacgcaggatgtgctggaactcctcac ccgcgatcagcgacatggcggcagtcggcgggggacgacggcgacgggcg gcggcggcggctgggggccgctcggggggtagggaagggagaattg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.