GrainGenes Sequence Report: Ta.5257.2.S1_x_at
Sequence
CA628605
Contig
Ta.5257.2.S1_s_at Ta.5257.2.S1_x_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC335115
NCBI UniGene
Ta.54928
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001063909.1 Os09g0558100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Clone Library
wle1n
Tissue
leaf
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
wle1n.pk0006.e12 wle1n Triticum aestivum cDNA clone wle1n.pk0006.e12 5' end, mRNA sequence.
Clone
wle1n.pk0006.e12
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Scott V. Tingey; Crop Genetics; E. I. DuPont de Nemours and Company; 1 Innovation Way, P.O. Box 6104, Newark, DE 19714-6104, USA; Tel: 302-631-2602; Fax: 302-631-2607; Email: Scott.V.Tingey@USA.dupont.com; Seq primer: M13. Note: Vector: pBluescript SK+; Site_1: EcoRI; Site_2: XhoI; Wheat (Triticum aestivum L.) leaf 7 day old etiolated seedling (normalized)
DNA
caccatcctgggctacatccccggcatcatctacgctgtctacatgctcg
tcgcgctcggctcggaggagcgtgatagggactacaacacacttgcttaa
taatcctgcaacaacttgtgattgtgtgatgcaccgcttgcccagttgtg
aattgacgtccctgtttatgttagtctgtaaatgcttaaaccgtcctccg
gtttctccatcctgtaattctgatacaaccgaataaaattcagcagctcc
gaaagatttaaaaaaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.5257.2.S1_x_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
