GrainGenes Sequence Report: Ta.15740.1.S1_at
Sequence
CA486623
Contig
Ta.15740.1.S1_at NSFT03P2_Contig2385
External Databases
Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene
Ta.15740
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001059841.1 Os07g0529600 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat meiotic anther cDNA library
Tissue
Anther
Developmental Stage
Meiotic stages pre-meiosis-metaphase I
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE4333_H05_O09ZS Wheat meiotic anther cDNA library Triticum aestivum cDNA clone WHE4333_H05_O09, mRNA sequence.
Strain
lab_host E. coli DH10B
Clone
WHE4333_H05_O09
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Plants were grown in a glasshouse. Anther meiotic stage was determined by removing anthers from individual primary florets. One anther was sacrificed for microscopic staging , and if determined to be between (and including) meiotic stages pre-meiosis and metaphase I, the remaining two anthers were collected and pooled for library construction. The tissue, total RNA, and poly(A) RNA were prepared, cDNA synthesised, and directionally ligated into pSPORT1 by Tim Sutton in the P Langridge Lab at the Department of Plant Science, University of Adelaide, Waite Campus, Australia. Average insert size 1.5Kb. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Plants were grown in a glasshouse. Anther meiotic stage was determined by removing anthers from individual primary florets. One anther was sacrificed for microscopic staging, and if determined to be between (and including) meiotic stages pre-meiosis and metaphase I, the remaining two anthers were collected and pooled for library construction. The tissue, total RNA, and poly(A) RNA were prepared, cDNA synthesised, and directionally ligated into pSPORT1 by Tim Sutton in the P Langridge Lab at the Department of Plant Science, University of Adelaide, Waite Campus, Australia. Average insert size 1.5Kb. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
ctgatcgtcaagggagggcgcgtcggcggcgtcgtcaccaactgggcgct
cgtgtccatgaaccacgacacgcagtcgtgcatggacccaaacgtgatgg
aggccaaggtggtggtcagctcctgcggccacgacgggccgttcggggcc
accggcgtcaagaggctgcaggacatcggcatgatcagcgacgtgcccgg
gatgaaggcactcgacatgaacaccgccgaggacgagatcgtgcgcctca
cgcgcgaggtcgtgccaggcatgatcgtcaccggcatggaggtcgccgag
attgacggcgccccgaggatgggcccgacgttcggcgccatgatgatctc
cgggcagaaggcggcgcacctggcgctgaaggcgctggggaggcccaacg
ccgtggacgggaccatcaaggtggtgtcgccggcgttgcgtcaggagttc
gtgattgcgtccaaggacgatgaggtcgtggacgcgtgagcgctgggagg
agcttagcgcgcgctctggcttcgttttttggactttgccttgttgatga
ctttgtccgaatgaattccctttcagttaaaaaaaaaaaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.15740.1.S1_at
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
