Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BU672182

[Submit comment/correction]

Sequence	BU672182
Contig	Ta.8095.1.S1_at NSFT03P2_Contig2578
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC299252
NCBI UniGene	Ta.8095
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, weakly similar to NP_191364.1 unknown protein [Arabidopsis thaliana]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Chinese Spring wheat drought stressed root cDNA library
Tissue	root
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE3301_E09_I17ZS Chinese Spring wheat drought stressed root cDNA library Triticum aestivum cDNA clone WHE3301_E09_I17, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE3301_E09_I17
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under normal conditions, then drought stressed to 80%, 70% and 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA was prepared separately for roots collected at the three different drought conditions. Equal amounts of total RNA were pooled from all three samples, poly(A) RNA were purified, one cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab at the University of California, Riverside (Fenton, Turuspekov). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ctgcttccgttctttatttgagacgtgtgcaggaaatggtttcagagaat accacccaaaagccacatgcccgcctcagaacgacagatttggattcagt gtactccccttccagaatcagtcatcgcatcagcagaacatgcatgcacc acctgcatattcaccgaccacaattgggccacacagtcactcgtgtgctg ctccaacaaatggatacttccagtatggtcagccaaccaatttcttctct ggtccagtcggattccgagtacctgggaacggacctgctgatttctcggt gcagtacaacaatgtccatcgctacccagctcctgcttttagttgtattc acccagagcaaattctcaagacaccggccagcttcagagtcatgcctccg cctcccctccccccttaccgacatggaacagcgccaactggtggtcatcc ttatggaggcttgaatccagacaggcttaattccatgttgaagccgatgg gcccgaaggatgctccagatggtaacaaattgcctgacaagagtgcatcc ttctcgttgttccaattcaacctgccgatagctccgcaaggcccaccgtc acccaaagatggtaagagtggagagtcggcagcaaggatgccgccatttg ctccggttcaagtgcagccatgctctagagagcagacagatgtgaaggag tataatctgttttccaccgatcaaagcgggtatttccctttatcccgtta aaagcaacac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.