Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig17118

[Submit comment/correction]

Sequence	BQ800912
Contig	TaAffx.69804.1.A1_at NSFT03P2_Contig17118
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Species	Triticum monococcum
Cultivar	G3116
Clone Library	Triticum monococcum vernalized apex cDNA library
Tissue	Vernalized apex
Developmental Stage	One month old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2804_B07_D14ZS Triticum monococcum vernalized apex cDNA library Triticum monococcum cDNA clone WHE2804_B07_D14, mRNA sequence.
Strain	lab_host E. coli XLOLR
Clone	WHE2804_B07_D14
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week , 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky ). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; One-month old plants were subjected to vernalization treatment by placing them in the cold room at 6 C, under 15hr light/9hr dark condition. Total RNA was prepared from apex tissue extracted from plants with no cold treatment; and from plants with 2-week, 4-week and 6-week cold treatment separately. Equal amount of total RNA was pooled from all four samples, a cDNA library was made using pooled polyA RNA and cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	gattcggacgaggaataatttacatatcgctgaaccgtacataagctttg acatagtacgtatttcatacaaaaattatcttgaattcattcaaaagtta cttgcattgatatagagaaattgtacaacatcatcacaaatctgtactcg acgacaacatgcagtccagcataaccaaatcttcatatgttcttcactca aaattgtgtttatttgtatgatattctgaactaaatttaagtatttctct gtatggaaggatcatattatcctgtaagaatatgttagaccctatttctt gtggtcagctgctttatattgtaagccgtcttatgttagaaataatttat gtagcttgaacagctgtaagtggtatgtgtattacccgaatgaagagtac agctatctgtgcaccgacggatggatatttctttcgttggagctcattgg ctgaggagacatgaagatctattttactctggacaaaaaaaaaaaaaaaa aaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.