Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ788867

[Submit comment/correction]

Sequence	BQ788867
Contig	Ta.9308.2.S1_a_at Ta.9308.2.S1_x_at NSFT03P2_Contig11876
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC284250
NCBI UniGene	Ta.37734
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001048765.1 Os03g0117100 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat CS whole plant cDNA library
Tissue	Roots, leaves, crown, stem and sheath
Developmental Stage	Adult
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE4154_G03_N06ZS Wheat CS whole plant cDNA library Triticum aestivum cDNA clone WHE4154_G03_N06, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE4154_G03_N06
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Plant tissues from wheat cv. CS grown to full tillering stage in greenhouse were collected at University of California, Davis (Jan Dvorak's lab, K. Deal and E. Akhunov). Total RNA was prepared from leaves (young leaf and third leaf), whole roots, crown, steam and sheath tissues, and then equal quantities of RNA were pooled from the these samples. PolyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in J. Dvorak's lab (E. Akhunov, J. Dvorak) at the University of California, Davis. Colony plating, plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tcggcacgaggcccagcagctaagcaccagccggccggacccgccgcttc tccaccctcctcccctctccccgctccgtcattaccaaggcaggaagatg tgctcgttggaggcgacgcgggcggagctggggctggcggtgctgtacct gaacaaggcggaggctcgggacaagatctgcagggccatccagtacggct ccaagttcatcagcaacggccagcccggcaccgcgcagaacgtcgacaag tccaccaccttggctcgcaaggtcttcaggctcctcaagtgggtgaacga cctgcatgctctcatcagcccagcccccaaagggacccctctcgtgttgg tcttgcttgggaagtccaagaatgcgctgctgtcgaccttcctgttcctg gaccagttcgtgtggataggaagatcggggatttaccagaacaaggagcg cacggaccgcatcgccaggatatccctctactgctggatgacttcctctg tctttgcaagtctagtcgagcttggagagctcaagaggctatccaaggcg atgaggaagcgcgccaaggagctccggggtgccgacaaatacgaggacga gcagtacctggggaagatgaagcagtcggacgaccggctgctggcgctgg tg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.