Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.12102.1.S1_a_at

[Submit comment/correction]

Sequence	BQ579313
Contig	Ta.12102.1.S1_a_at NSFT03P2_Contig13995
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC281009
NCBI UniGene	Ta.54975
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001056338.1 Os05g0565400 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Brevor
Clone Library	Wheat dormant embryo cDNA library
Tissue	Seed embryo
Developmental Stage	Mature seed
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2969_A09_B17ZS Wheat dormant embryo cDNA library Triticum aestivum cDNA clone WHE2969_A09_B17, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2969_A09_B17
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown to seed maturity under conditions favoring seed dormancy (L. Dohery at K. Walker_Simmons lab, Washington State University, Pullman, WA). Embryos were cut from mature dormant seed (Doherty). Total RNA was prepared from these embryos, polyA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Chin, Fenton). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	accttcagcagcaagaatggcagcgccgggctcgctaggacttctccagg cgccgtccttcgccgcggccaagtgccgtccggtgacggccacgagccgg ggagcggcacgagccgtgttcgccgtccgcgcctcggcagcttctgcggc caccaaggacgcagttctcaggcccttccgtgagaacagggctctcaaga tcatttcggggcttcagaacttcgacaggtccaatgttgcgtctgtcgtc acggctgcggataagggaggtgctacccatgttgatatagcatgtgacca ggacttggtaaagcttgcgctggagcttactaaccttccgatatgtgtat cgtctgttgacccttcatcattccaatctgcggtagaagctggtgcgcaa atgattgagattggaaactatgattccttttacgatgcaggcatcgaatt ctcttctgagcaaatactgaacttgacaagggagacaaggaagatacttc cagacatcacattgtcagtaacagttcctcacactctgagcctcccagat cagatgagacttgcagagctacttgaagaggaaggtgccgatatcatcca gactgaaggtgggaagtgttctaatccgacaaagcctggggtgcttggcc taattgaaaaggcaacaccaacattggcagccgcatactccatctccag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.