Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.1425.1.S1_a_at

[Submit comment/correction]

Sequence	BQ483797
Contig	Ta.1425.1.S1_a_at NSFT03P2_Contig13428
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC298126
NCBI UniGene	Ta.1425
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001049658.1 Os03g0266700 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat unstressed root cDNA library
Tissue	Roots
Developmental Stage	Full tillering
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE3512_G04_N08ZS Wheat unstressed root cDNA library Triticum aestivum cDNA clone WHE3512_G04_N08, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE3512_G04_N08
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Plants were grown until full tillering stage and root tissue was collected at Texas Tech Univeristy (Zhang, HT Nguyen Lab ). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab (Close, Fenton) at the University of California , Riverside. Colony plating, plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Plants were grown until full tillering stage and root tissue was collected at Texas Tech Univeristy (Zhang, HT Nguyen Lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab (Close, Fenton) at the University of California, Riverside. Colony plating, plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttcggcacgaggaaaagctagctgaggattgttgcaaatattggaaacaa caatcaaaatcttggttttgttctgggaaaggcttcagttgagtttggta aatcccacagccaaatggagatagagcgggagaaacttcttagagttctt ggagagcaggtttttgagcctcttcgagaaatgataatgagtgctcctct tgaagatgctcgcttgttaacttaccgctatcaacggatcagacaagata tggagtctcagatagctgatgtggttagaaggcaactgaagtcgaaggag agtagtggtaatacagattcggtgaaactgcaacatgcagagtcaaaact atcagagctccgaactacgctggcagcattaggaaaggaagcaacggcag ctatggaggctgtagaggctcagcagcaacagattaccttcgatcgtctt cttgcaatggttgatgccgagagaacttaccatcagaacgttgctgatat tctgaacaaacttcatgatgagatgctcaatgcaagaccccatgaagagt cagacaacaacgatgacgtgccatcatcagatccatcatcggagcctaaa gtatcatcacctaaagtatcaccgacacatgtgcactcaaatagcatatc agaagatccagcattaactgaaactagcgaacctacaaggaatggtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.