Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ472443

[Submit comment/correction]

Sequence	BQ472443
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC158705
NCBI UniGene	Hv.23108
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'B3-hordein fragment'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	BC
Tissue	developing caryopsis
Developmental Stage	8-15 DAP (days after pollination)
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HB09K02T BC Hordeum vulgare subsp. vulgare cDNA clone HB09K02 5-PRIME, mRNA sequence.
Strain	lab_host XL10-Gold vulgare
Clone	HB09K02
Probe	GBS547
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 700 Std Error: 0.00; Plate: 9 row: K column: 2; Seq primer: T3. Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); developing caryopsis , 8-15 DAP(days after pollination) Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable. Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); developing caryopsis, 8-15 DAP(days after pollination) Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.
DNA	cggcacgaggccacaaccattttcacaacagcccatcccacaacaaccac aaccatacccacaacaaccacaaccatttccacaacaacccatcccacaa caaccacaaccatacccacaacaaccacaaccatttccacaacaaccctt cccatcacaacaaccatttccgcaacaaccaccattttggcaacaacaac caattctatcgcagcaacaaccatgtacaccacaacaaacaccactccca caaggacaacaagatcaaatgcttgtgcaagtacaaataccatttgttca tccatctattttgcagcagctaaacccatgcaaggtattcctccagcaac agtgcagccctgtggcaatgtcacaacgtattgcaaggtcgcaaatgttg caacagagcagttgccatgtgttgcagcaacaatgttgccaacaactgcc gcaaatccccgaacaactccgccatgaggcagtccgtgcaatcgtctact ctatcgtcctgcaagaacaatccctacaattggtccaaggtgtctcccaa ccccaacaacagtcacaacagcaacaagtcggacaatgttctttccaaca acctcaaccacaacagggtcaacaacagcaagtgccacagagtgttttct tgcagccacaccaaatagctcaacttgaggcgacaacttccattgcgctg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.