Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig1519

[Submit comment/correction]

Sequence	BQ294679
Contig	Ta.94.1.S1_at NSFT03P2_Contig1519
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC277236
wEST map position	BQ294679
NCBI UniGene	Ta.94
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'TFIID mRNA encoding DNA binding protein'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	5AS 5BS 5DS
Clone Library	Wheat unstressed root tip cDNA library
Tissue	Root tip at 1.0 to 1.5 mm stage
Developmental Stage	Four-day old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2853_B10_D19ZS Wheat unstressed root tip cDNA library Triticum aestivum cDNA clone WHE2853_B10_D19, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2853_B10_D19
Probe	MAG690
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions for four days. Root tips were excised and snap frozen (Ross and Gustafson) and total RNA was prepared at University of Missouri, Columbia. Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(- )phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions for four days. Root tips were excised and snap frozen (Ross and Gustafson) and total RNA was prepared at University of Missouri, Columbia. Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-)phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.94.1.S1_at 626 WHE2AFFY Ta.94.1.S1_at 174 WHE2AFFY Ta.94.1.S1_at 78 WHE2AFFY Ta.94.1.S1_at 573 WHE2AFFY
DNA	aagtaaagcagaattggagacattgttgcttgctgccagctccaacctcg caaagtctaggcatagcccgtcttccggtggaaaaccctatatatatata tactgtccatcagatttggagtacctgttgtcgtaatcgactagggttct tctttttgtgatggatcatggttgatcatcgcaggtatcatcgcaggtct attctgtcatggcatcgtccctcactcgaaacactcttgtggaagttgag tgaaacccaagcaaattttgctcctggattctagagcctttttctcctga tgatgtgatgatgaaaacgccagctgatgtatattcacttgtagacgcgt ttgcgccctgttaaaaggagggcttcatgtcgagccgaatagcaagagga aaatttgtgttatttctatccctttgtgctgtctcggtcgtcgcatttgt gccgaccatttaacatttgccg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.