Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ283120

[Submit comment/correction]

Sequence	BQ283120
Contig	NSFT03P2_Contig5606
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum aestivum (bread wheat)
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat cold-stressed seedling subtracted cDNA library
Tissue	Seedling
Developmental Stage	Five-day old seedling
Data Source	genbank Release 135, Apr 15 2003
Title	WHE3086_D02_H04ZS Wheat cold-stressed seedling subtracted cDNA library Triticum aestivum cDNA clone WHE3086_D02_H04, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE3086_D02_H04
Remark	DB_xref: taxon:4565 Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized ,germinated and grown aseptically in the dark at room temperature on filter paper with water,nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made,and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi,Close,Fenton) at the University of California,Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before subtraction was carried out. The mass excision of phagemid library and subtraction were done in HT Nguyen lab by D. Zhang at Texas Tech University. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	TaAffx.85373.1.S1_at 490 WHE2AFFY TaAffx.85373.1.S1_at 317 WHE2AFFY Ta.24519.1.S1_a_at 248 WHE2AFFY Ta.24519.1.S1_a_at 151 WHE2AFFY
DNA	agcttgtcagtgttgaagatttgtccgtcagcactgggctacatatggtc gccattattacacacgctatgactatgagaatgttgacgctggggctgct aaagagcttatggcaaacctagtaagcatgcagtcatcactttctgatgt caacaagctgatcaaggagatccggtctgatgtttctgaagtagttgcag ctgacgagtttgagtacaaagatcctgttgatggctctgtgtccaagcac cagggcatccggtacctcttcggagatggttcgcgactggtgttccgcct ctctggaactggntctgttggtgccaccatccgtgtctatatcgagcagt acgagaaggattcctccaagatcggcagggattcacaggatgctcttgct ccgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.