Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ281004

[Submit comment/correction]

Sequence	BQ281004
Contig	Ta.6130.1.S1_at Ta.6130.2.S1_a_at Ta.6130.3.S1_a_at NSFT03P2_Contig5989
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	BQ281004
DB Remark	Locus Source: Triticum aestivum (bread wheat)
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	6BL
Clone Library	Wheat unstressed seedling shoot normalized cDNA library
Tissue	Etiolated shoot
Developmental Stage	Five day old seedling
Data Source	genbank Release 135, Apr 15 2003
Title	WHE3007_C12_F23ZS Wheat unstressed seedling shoot normalized cDNA library Triticum aestivum cDNA clone WHE3007_C12_F23, mRNA sequence.
Strain	lab_host E. coli DH10B
Clone	WHE3007_C12_F23
Remark	DB_xref: taxon:4565 Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares'. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.6130.1.S1_at 1001 WHE2AFFY [ Show all 7 ]
DNA	ggttgccaaagacccagaggacagaacagatactgtaatcactgtatacg gcgatgctacacctgttcctgatgaagaaaaagatgcagtgagaactgca tatttacggagacaccctgaggccttttgggttgactttggtgacttccg ttttctgcacatcaaaccaaaagctgtacgttacgtatctggggttgcaa cagctatccttggctctggagagtttagtgcagctgagttcaaggaagca aaagtggatcctatatctcagttctccactcctattgcaggccacatgaa caaggatcatgctgatgatacaaagctcatcgtgcaacactcaacctctg ttaaaggtggatttcgcttctattctnggatgtggatagcctcggtatca atgtgaaggctggttatgatggaactgttctgaagctgcgaattcccttc cctagacgtgcgcaagacagaaaggatgttaagacacttatttgtggaaa tgctacaggctgcaaaggcctcatcctgacatgctgaatgacctctttgt ctgga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.