GrainGenes Sequence Report: Ta.23415.2.S1_a_at
Sequence
BQ172185
Contig
Ta.23415.1.S1_at Ta.23415.2.S1_a_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC350786
wEST map position
BQ172185
NCBI UniGene
Ta.23415
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
3AL
Clone Library
Chinese Spring wheat drought stressed leaf cDNA library
Tissue
Leaf
Developmental Stage
Full tillering stage
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE2009_D05_G09ZT Chinese Spring wheat drought stressed leaf cDNA library Triticum aestivum cDNA clone WHE2009_D05_G09, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE2009_D05_G09
Probe
WHE2009_D05_G09
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton , Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
ttttttttttttttttttttttacagtctggaccgccgtggatccacaca
tacatagaaaattgcatcttaacaattcacacacaatctttaataattca
gtacaccataagagaaaatgctctaatcatacatcagacatcagaaccat
gaaactacttattcaatcacaccaataattttcccattaactgtctttca
gtcttcctactaatgccgaatcgcttatcccaaaagcacaggttgtaaaa
gtcataggcttctcccgaagtatcaaaactcgtccccaatgtcagcacta
tgacattgtcccctggattttccgagaaacctcgaattatcttcggcagc
acctgtcctcaccattaccaaaacctagcagccatccatagtcttactgc
gaagccgtcagttctgcaaatttcaccaacatggtcggacgatgtggtgt
gtggctgcagggggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.23415.2.S1_a_at
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
