GrainGenes Sequence Report: Ta.9395.2.S1_at
Sequence
BQ169568
Contig
Ta.9395.2.S1_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC284731
wEST map position
BQ169568
NCBI UniGene
Ta.9395
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001067937.1 Os11g0497000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat pre-anthesis spike cDNA library
Tissue
Spike before anthesis
Developmental Stage
Adult plant
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0954_H01_P02ZT Wheat pre-anthesis spike cDNA library Triticum aestivum cDNA clone WHE0954_H01_P02, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE0954_H01_P02
Probe
WHE0954_H01_P02
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
ttttttttttttttttggatccaaacaagaatcaacgttatcccttacca
gcgtaaacagatgacgttacaaatcggggaaccaaacacctcctaagtac
cagtgacaaaaacgctaaaatgctaagttaagtttccagcctcagcca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.9395.2.S1_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
