Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ168403

[Submit comment/correction]

Sequence	BQ168403
Contig	Ta.6770.1.S1_at Ta.6770.1.S1_s_at NSFT03P2_Contig16010
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC301205
wEST map position	BQ168403
NCBI UniGene	Ta.6770
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001046948.1 Os02g0514500 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2AL
Clone Library	Wheat salt-stressed crown cDNA library
Tissue	Crown
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2104_F06_L12ZT Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2104_F06_L12, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2104_F06_L12
Probe	WHE2104_F06_L12
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttttttacacaggcacaaacactagtggatttcac cctgatgcaaacaatcggacgggtcgtggtggccctgatttacatgccgc atccgggccttggggtttcagttccgaggtgtcaaagattggtcaaccta cacgggcgcaccgtggatactactatccgagaagaagacgcgctactgta cgagctcgggtatgagcctcagcaggaaggaaatctcccgctgcgagaag ttgggcgtcttcttcgccggcgcagccctatccagtcccaaccttccggc ctggccttcttcggggctgggctccggtgcgaccacggccgcgaactccg aaacggcctcggcgatctcctgcaccaggtcgacgatcacgccgtccacc cccatcaggtgctgcatgtacaccgcctccggcacgttgttgagctgccc gtaggtgagcagggagaggtcggactccttgaccctggctaccgccgacg ggtgccggaacaagccctggcctccgacacgatgccctgcaggccgccgg cgcggcacagcctgacagcctcctccaacgagttccgccttgcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.