GrainGenes Sequence Report: BQ167575
Sequence
BQ167575
Contig
Ta.9244.1.S1_x_at NSFT03P2_Contig1409
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC283795
wEST map position
BQ167575
NCBI UniGene
Ta.1546
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001045083.1 Os01g0896800 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Cheyenne
Chromosome
2AS 2DL
Clone Library
Cheyenne wheat endosperm cDNA library Wheat endosperm cDNA library
Tissue
Cheyenne endosperm Endosperm
Developmental Stage
5 -30 days post anthesis seed 5 to 30 days post anthesis seed
Data Source
genbank Release 136, Jun 15 2003 genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0075_G09_M17ZK Cheyenne wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0075_G09_M17, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE0075_G09_M17
Probe
WHE0075_G09_M17
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: Stratagene's KS primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, Cheyenne endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA
ttttttttttacaacgtcaaaatcccagcaccttgtataatgtaagataa
tccaaaactccagcatggtactcaaaaccaagaggcaggtacaatgtgca
tatatgtctctctcgcgatactactgtttaatgccgagcaagttcatttg
gaagcatgaagacagcactatagggggcctagggtcgattacactcattc
atcgtcgtcctcatcatcatcagcaccagcagatgagttgagggcgttga
gccgctctacaagattggccttcctctgctcataggtcangcttcttggg
attgtacctcttgtgcgtctttggaggttccttggttgactttgccatgg
taggatcagcacgaatggcagcatgaaccttcttgtacagtgattccatg
ttatcagcctcaatccccttcttgatgtactcactgaagtgagattggta
cttctcaggttcctcgtcagccagtgacttcatgtagtcagcaacatgcc
ctccatagatgtattttgcggtgaatctcagcgtccagctgcttctcgtc
cttcttgaagccagcaaatctcttgtcactgtgcggaatatcaagaccac
catccaaagctcccttgagggca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BQ167575
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
| |||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
