Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ160358

[Submit comment/correction]

Sequence	BQ160358
Contig	NSFT03P2_Contig18645
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC4298
wEST map position	BQ160358
DB Remark	Locus Source: Secale cereale (rye)
Keyword	EST
Species	Secale cereale
Cultivar	Blanco
Chromosome	2AL
Clone Library	Secale cereale anther cDNA library
Tissue	Anther
Developmental Stage	Adult plant before anthesis
Data Source	genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	WHE1805-1808_O07_O07ZT Secale cereale anther cDNA library Secale cereale cDNA clone WHE1805-1808_O07_O07, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE1805-1808_O07_O07
Probe	WHE1805-1808_O07_O07
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Anthers were harvested and pooled from early meiosis to late meiosis. The tissue, total RNA, and poly(A) RNA were prepared (Butler, Ross and Gustafson) at University of Missouri, Columbia. A cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttaacaaagggtacttaattatttattgtggatta attattggagccaacaattacagtatatcatcatacgtagtaaatggact gaatatttccgcatatattccccccctatacatatcaagcatagcaacca gttttcttcaccatagttacagcttacagctaattaatcaacttcaattg ctggtaggaaagagcagcattatattatatgtagatgcggttgtcttctt ctctcttcacagcctcgagtggtcctggtattgctccatgaacgtgtcgt tgaacttcttgaagctcgacatgatcgccggcatgtcctcctccgcgggc aggatcgtcgtcctcagatggaacaccccttctttctgaccaaaacctga acctggaacagtggatattccagtggcttccagaagcttgaggcagtagt aaacatcgggcgctttgccagcgctctttgctacatccatagctctttgc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.