GrainGenes Sequence Report: Ta.8525.3.S1_a

Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20. No effort was taken; to identify ESTs of fungal origin from this library, thus this EST; could be of wheat or fungal origin.; Seq primer: Stratagene SK primer.

Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes were sprayed at anthesis with Fusarium graminearum. Total RNA, and poly(A) RNA were prepared and pooled from infected spike at 0, 6, 12, 24, 36 and 48 hours after inoculation, a cDNA library was made , and the cDNA clones were in vivo excised to give pBluescript phagemids in G. Muehlbauer lab at the University of Minnesota (Kruger, W.M., Muehlbauer, G.J., Pritsch, C., Vance, C.). The cDNA library should contain genes of both wheat and fungal pathogen origin. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes were sprayed at anthesis with Fusarium graminearum. Total RNA, and poly(A) RNA were prepared and pooled from infected spike at 0, 6, 12, 24, 36 and 48 hours after inoculation, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in G. Muehlbauer lab at the University of Minnesota (Kruger, W.M., Muehlbauer, G.J., Pritsch, C., Vance, C.). The cDNA library should contain genes of both wheat and fungal pathogen origin. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).

DNA Homology

Ta.5359.1.S1_at	190	WHE2AFFY
Ta.5359.1.S1_at	101	WHE2AFFY
Ta.8525.3.S1_a_at	186	WHE2AFFY
Ta.8525.3.S1_a_at	178	WHE2AFFY

DNA

ctaaggttgctgagcgacactaaaaaatttagaaacttgtggggttcttg
ctggtaccctgaaaaagaaacttttcatattacaaccttaataattccaa
acagaaatctacatctgattcgtgtgaagctacaaatgaagaagaactat
ttgaagttcagacagggctcactattcacccttggttggattcatgcaca
tccaacgcagtcctgtttcctgtcctctattgacctccataatcattatt
cgtaccaggtcatgctacctgaggcaattgcaatagttatggcacctacc
gacacaagaaaaaaacacggtatatttcatctaacggatcctggtggtat
tggtgtgatccatgattgcccggagagaggatt


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.