GrainGenes Sequence Report: BI948599

HVSMEl0010D09f Hordeum vulgare spike EST library HVcDNA0012 (Fusarium infected) Hordeum vulgare subsp. vulgare cDNA clone HVSMEl0010D09f, mRNA sequence.

Strain

lab_host TJC121

vulgare

Clone

HVSMEl0010D09f

Probe

kr65A0802

Remark

DB_xref: taxon:112509

Feature: source: mol_type = 'mRNA';

Locus Comment: Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 311; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 436.

Note: Vector: pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Plants were grown at the University of Minnesota in the GJ Muehlbauer lab; spikes were harvested and snap frozen at 0, 1, 2, 3, 4, 5, 6, and 8 days after Fusarium graminearum inoculation (Heinen). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all eight RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Fenton, Malatrasi ). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

Note: Vector: pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Plants were grown at the University of Minnesota in the GJ Muehlbauer lab; spikes were harvested and snap frozen at 0, 1, 2, 3, 4, 5, 6, and 8 days after Fusarium graminearum inoculation (Heinen). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all eight RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Fenton, Malatrasi). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

DNA

aagcactccaaagccactccctttcctcatctctctctcgctcacctata
catgatcatctcctctgcctaacaagctaagcagctcagctcaagcatcg
gcaatggagggcaaggaggaggacgtgcgtctgggcgcgaaccggtactc
ggagcggcagccgattgggacggcggcgcagggcggcggcgcggacgata
aggactacaaggagccgccgccggcaccgctgttcgaggcggaggagctg
acgtcgtggtccttctaccgcgcggggatcgccgagttcctggccacctt
cctgttcctgtacatcagcgtgctcacggtgatgggcgtggtgggcaacc
cctccggctccaaatgcggcaccgtgggcatccagggcatcgcctggagg
ctccggggcatgatcttcgtgctcggctactgcaccgccggaatctcctg
cggccacatcaaccccggcggcaccttcgggctgtacctggcaagaaact
ggcgctcacccgggccggtatc


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.