Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig12164

[Submit comment/correction]

Sequence	BG606631
Contig	Ta.20248.1.S1_at NSFT03P2_Contig12164
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Species	Triticum monococcum
Cultivar	DV92
Clone Library	Triticum monococcum early reproductive apex cDNA library
Tissue	Early reproductive apex
Developmental Stage	Seven week-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2451_A10_A19ZS Triticum monococcum early reproductive apex cDNA library Triticum monococcum cDNA clone WHE2451_A10_A19, mRNA sequence.
Strain	lab_host E. coli XLOLR
Clone	WHE2451_A10_A19
Probe	CFE173
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tactgatgcacatgttccccaaggtacatcagcatccctgagtgtgaatc cgtttacaagtatccaaccctcagctgggtcatacgcacaagcaacatcc gggcatgctcccagacccagcctcagtgaccagtcaaagaatacaatatt ctcaaatgcattatcaagcccggtccgcaggagcctccagacgtatcact gaacccaaggtgctggtaatggaggacggaacactgaagcaaacgcagcc gggcaaaaccgagaggccaactctgcaagctccaatgatacctccatgga catggtttcagacagcgcgggaaatgggtactactaagtcagtttctgga aacatgttgcatgcacaaccaggaagcattgagtgccagtattttctctg gtttttgtatgttatgtatttttcctaaagctcatgcactgtgtggctnt atagttgcacacctggcgattcacttaaagttattggatttgttttcttt tgt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.