Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG604763

[Submit comment/correction]

Sequence	BG604763
Contig	NSFT03P2_Contig9040
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC323069
wEST map position	BG604763
NCBI UniGene	Ta.13208
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001059140.1 Os07g0203700 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2BL 2DL
Clone Library	Wheat 5-15 DAP spike cDNA library
Tissue	Spike
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0941_H07_O13ZS Wheat 5-15 DAP spike cDNA library Triticum aestivum cDNA clone WHE0941_H07_O13, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0941_H07_O13
Probe	WHE0941_H07_O13
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.13208.1.S1_a_at 333 WHE2AFFY Ta.13208.1.S1_at 333 WHE2AFFY
DNA	gtcccatgtgactccagtatcttctgtggattgccccagcggcctgctat ttgttgcagagaactgtttacatttggttgaaatggttcatggcaaaaga ttaaatgcacaaaagttttcagttggagggactccaaggaaagtgctata ccacagcgatagtagaacactgttggtcatgagaactggtttaactggtg catcgtgttcttcagatattgtccaaatagatcctaataatgggat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.