Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig3756

[Submit comment/correction]

Sequence	BG604385
Contig	NSFT03P2_Contig3756
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC316507
NCBI UniGene	Ta.7984
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001054723.1 Os05g0160800 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Cheyenne
Clone Library	Wheat subtracted endosperm cDNA library Wheat endosperm cDNA library
Tissue	Endosperm
Developmental Stage	5 -30 days post anthesis seed 5 to 30 days post anthesis seed
Data Source	genbank Release 136, Jun 15 2003 genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2506_H01_O02ZS Wheat subtracted endosperm cDNA library Triticum aestivum cDNA clone WHE2506_H01_O02, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2506_H01_O02
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab. The library was enriched for low-copy cDNA sequences by removing highly abundant cDNAs using colony hybridization. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA	tcgcctcctcccccctctccctggcggcgccgtcggcagccatgcgcaag aagctgcagcgcaaattccggctgcgtggcttcaccctcaaagttgacgc cctcgaggaggcggccgccttcctcgcccgcttccccgacgccgaggacg aggccctcgacctcctcctcgacgagctcgacaaagagccgctgaagtcg tcgatactggaccgggacgcggtccgtcgcgtggtgtccctactggtcga ggcggaggaggcggtcgacgcggcgtcgccttccgccaccagcgtccagt cggcgctgcgggtggtggactcgttcgtcgtgccgcggttccactacgac ccaatcaagaaagtgttctacgagcatactggaagattagccctccatgg agaagctggagataaagccgccctttacagggatagatatcaagtgctgc ttcagaggctcgctcgtgataaatatttctccaagccagcttttgagtct gttatgactgaaaatgaaagttgtgagattacttccatacagtcctt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.