Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG414682

[Submit comment/correction]

Sequence	BG414682
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Hv.7078
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, weakly similar to NP_001048492.1 Os02g0814400 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	Morex
Clone Library	Hordeum vulgare testa/pericarp EST library HVcDNA0013 (normal)
Tissue	testa/pericarp
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HVSMEk0003F14f Hordeum vulgare testa/pericarp EST library HVcDNA0013 (normal) Hordeum vulgare subsp. vulgare cDNA clone HVSMEk0003F14f, mRNA sequence.
Strain	lab_host TJC121 vulgare
Clone	HVSMEk0003F14f
Probe	[BG414682.1] {SpCl-411}
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: On Mar 13, 2001 this sequence version replaced gi:13320233.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 192; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 722. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were raised from seeds in a Controlled Environments growth chamber maintained in continuous light at 18oC, and testa and pericarp were dissected from developing kernels at Washington State University, Pullman, WA (Kannangara, von Wetstein). Total RNA was prepared, poly(A) RNA was purified, one cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates , Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were raised from seeds in a Controlled Environments growth chamber maintained in continuous light at 18oC, and testa and pericarp were dissected from developing kernels at Washington State University, Pullman, WA (Kannangara, von Wetstein). Total RNA was prepared, poly(A) RNA was purified, one cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA	gccacacacacacacacacacggacacacctgcgccggagctcaaacctc aagcgttccaatggcgggggtcgcgtgcccggtctacccgtggccgaccg acgcgtaagcacatcctcgtcgtcacggagctcttcttcttcttctgaat atctcatggggattgattgctggttgtgatggaacagcaaggcgcaacgc ggggccaaagtgttcatgcagaaggactgcgccgcgtgccactccgcgct cccctacgccggcctccgggacgcgcccgtgctaggccaactgggaccca ctacggccgagatcctcgttgccgccgccacgggcaccgaagaagcgatg ccgccgccggcgacgacaccgctccagcacacgccggaccttgccaccgt cgtcacaaagattccaggcgggctgcgctgcaacctttactccaccggga cggcggcgacgcccgtcagggcgatgctccccgaccgcgcccctgtggcg tgccaagaactcaagaaaaacccccgtctggctgcaatttgcccaggctt ttcaagccacttgatgggttggacgacccaatctttaatgacacgccttg ctttgccccatctcatctcatttctgtccaataccatggtgtgtctgtca ctgtcacgtctttataaaatacattacattgcaccttgtgctggatcaag ccgtatcaaaattaaaaaaaaaaaaaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.