GrainGenes Sequence Report: BG366871

Locus Comment: On Mar 8, 2001 this sequence version replaced gi:13255970.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 109; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence start: 7; High quality sequence stop: 503.

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spikes with awns trimmed were collected at 20 DAP (Fenton ). Total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Choi). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates , Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spikes with awns trimmed were collected at 20 DAP (Fenton). Total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Choi). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:

DNA

caagcgcagagcgagatccatagaccaccagcggcggaggactgtccagc
cacagcggatgtagttattgccaacaccaccaccaccaccttgctacgtc
cctgactacgatccaatctccgtcctccgatgacgtcgactacgactccc
acgacctgggtgtccaagatattctgtacgaaaaggctgacggtgaggac
atccagccccttgtctgcgacaatggaaccggaatggtcaaggctggttt
cgctggagatgatgcgccaagggctgtctaccctaacatacttggtcacc
ctcggcacactggtgtcatggtagggatggggcacaaggatgcttatgtt
ggtgatgaggcgcagtccaggagaggtgtcctcacgctcaagtaccccat
cgagcacggtatcgaaagcaactgggatgacatggagaaaatctggcata
cactttctacaatgagctccgtgtggcacccgaggagcacccctgtgttg
ctcactgaggg


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.