Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG366844

[Submit comment/correction]

Sequence	BG366844
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC181349
NCBI UniGene	Hv.11248
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'HvPIP1;5'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	Morex
Clone Library	Hordeum vulgare 20 DAP spike EST library HVcDNA0010 (20 DAP)
Tissue	20 DAP spike
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HVSMEi0008J13f Hordeum vulgare 20 DAP spike EST library HVcDNA0010 (20 DAP) Hordeum vulgare subsp. vulgare cDNA clone HVSMEi0008J13f, mRNA sequence.
Strain	lab_host SOLR vulgare
Clone	HVSMEi0008J13f
Probe	BG366844
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: On Mar 8, 2001 this sequence version replaced gi:13255943.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 257; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 491. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spikes with awns trimmed were collected at 20 DAP (Fenton ). Total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Choi). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates , Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spikes with awns trimmed were collected at 20 DAP (Fenton). Total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids in the TJ Close lab at the University of California, Riverside (Choi). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA	cattggactgccccactcgacactcccgtgctcctccctcattcatcacc ctcctcgccgctttccagagccaccttcctcactcactcactcactcacc cccgctcatgcctttataactcgcctgtactccaccaccccatagctcac aacgcacccaccggagcagccagccagagagagagaggataatggagggg aaggaggaggacgtgcggctgggcgccaacaggtactcggagcggcagcc catcgggacggcggcgcanggcggcggggacgacaaggactacaaggagc cgccgccggcgccgctcttcgagcccggggagctcaagtcctggtccttc taccgcgccggcatcgccgagttcatcgccaccttcctcttcctctacgg taccgtgctcaccgtcatgggcgtctccaaggccccctncaagtgcgcca ccgtctgcgtccagggcatcgcctgatccttccgcggcatgatcttcgcg ctcgn

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.