Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG314283

[Submit comment/correction]

Sequence	BG314283
Contig	TaAffx.70985.1.A1_at NSFT03P2_Contig15835
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	BG314283
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Germplasm	T. monococcum ssp. monococcum DV92
Species	Triticum monococcum
Cultivar	DV92
Chromosome	3DS
Clone Library	Triticum monococcum early reproductive apex cDNA library
Tissue	Early reproductive apex
Developmental Stage	Seven week-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2461_E07_J13ZS Triticum monococcum early reproductive apex cDNA library Triticum monococcum cDNA clone WHE2461_E07_J13, mRNA sequence.
Other Name	WHE2461_E07_J13ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli XLOLR
DNA Library	TM043E1X
Clone	WHE2461_E07_J13
Probe	WHE2461_E07_J13
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	TaAffx.70985.1.A1_at 1197 WHE2AFFY TaAffx.70985.1.A1_at 682 WHE2AFFY Ta.17401.1.S1_at 309 WHE2AFFY Ta.17401.1.S1_at 291 WHE2AFFY
DNA	ttttttttttttttttttgacgaatttctccgtttcatattccataatca cctctcanaacaccaagatacattaccaccggccacgtgaatcgcagcaa gttaccgagacaaagtttatacagaacctcattaaaacagcttccagatt ttccacacacagacaaccaaataagaccagtaaagccgagacaaatgttg tccgtggatcaaaatgatatatcaccgagctaaaataaaactagcagaaa agagtaagttttagtcgctatcatcttcgtcttcttgcgtttcaagctgg gagacaaccttttctatgaacttcctgcgaacgccttccatgacattatt acgggatgaatcgccaccaccttgtccatcattcagtactgggtctgaat ggcaaagcgccaatgcaacagattcaggtgtgcatttctttccaccaaac ttctgtagaccaacataagtccctttgacagcactgttgttgtacaccag tattgtaggaacatttctatctgggtagttgggaatacagtccgtggaaa taattttaacaaacttggtttctgcatatttcggcgccagttcctccagg caagtctcaagcagcccacattctg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.