Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig9287

[Submit comment/correction]

Sequence	BG273995
Contig	NSFT03P2_Contig9287
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	BG273995
DB Remark	Locus Source: Aegilops speltoides
Keyword	EST
Species	Aegilops speltoides
Cultivar	F2 from 2-12-4-8-1-1-1-(1) x PI36909-12-811-(1 ) F2 from 2-12-4-8-1-1-1-(1) x PI36909-12-811-(1)
Chromosome	4DS 5BL
Clone Library	Aegilops speltoides anther cDNA library
Tissue	Anther
Developmental Stage	Premeiotic anthers
Data Source	genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	WHE2232_B11_D22ZS Aegilops speltoides anther cDNA library Aegilops speltoides cDNA clone WHE2232_B11_D22, mRNA sequence.
Other Name	WHE2232_B11_D22ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	AS040E1X
Clone	WHE2232_B11_D22
Probe	WHE2232_B11_D22
Remark	DB_xref: taxon:4573 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at the University of California, Davis (Akhunov). Premeiotic anthers were harvested, total RNA and poly(A) RNA were prepared, from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons , Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at the University of California, Davis (Akhunov). Premeiotic anthers were harvested, total RNA and poly(A) RNA were prepared, from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	TaAffx.43419.1.S1_at 410 WHE2AFFY TaAffx.43419.1.S1_at 301 WHE2AFFY Ta.13694.1.S1_a_at 105 WHE2AFFY
DNA	ccgctactcgcctctctcttgcgcgcgatgccggccaccagtcacctctc tctcgcgtgcgcaacgccgctctctccccgttgatgcgccctctctctcc ttctcgccggcatcttgctccgcttcgccgctcaccgctccccaccacac aaagctaccatttttattcgccagcgacgcgctgctgggcgaggaggagc tggatccacatgcgctggtcctcgatctgcttgtggataggtgtgaggag tcgctgaagcggagtccgagcggcaccggcgcgggcgtgaagatgacggc gggaggatctagagcccgagcgggaggatctggagccgcatctcaagtac tccggtgacgcaacgacacttgatgtggagccccaccggcgccgttgccg gtggtggggcaccagttctgtgcgccctacgtggtgccgctga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.