Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF621187

[Submit comment/correction]

Sequence	BF621187
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Hv.9181
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, weakly similar to NP_001050961.1 Os03g0692700 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	Morex
Clone Library	Hordeum vulgare seedling shoot EST library HVcDNA0001 (Cold stress)
Tissue	Seedling shoot
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HVSMEa0004P08f Hordeum vulgare seedling shoot EST library HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare cDNA clone HVSMEa0004P08f, mRNA sequence.
Strain	lab_host TJC121 vulgare
Clone	HVSMEa0004P08f
Probe	BF621187
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: On Dec 18, 2000 this sequence version replaced gi:11884921.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 439; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 622. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Seeds were surface sterilized then germinated under axenic conditions in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated at 5oC for 2 days. Shoots were then harvested, total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 600000 pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close laboratory at the University of California, Riverside (Choi, Close, Fenton). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations , DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main ). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Seeds were surface sterilized then germinated under axenic conditions in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated at 5oC for 2 days. Shoots were then harvested, total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 600000 pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close laboratory at the University of California, Riverside (Choi, Close, Fenton). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA	ccgacgacgacgacgactacgacggccatgtctcccatgacagtcctcct cgtcctcgccgtcgccgcgacggccgcgccgctggcgcacgcggcctgcg ctgacggcagcgacggcgccatgctgcacggcgtggcgaacgacgtgctt ctggagtacggctctccccaagggcctcctcccggactccgtcgtctcct acaccttcgacaacgccaccggtaacttccacatcgagctcgccagcagc tgctacgtctggttcggcgaccactacgtctacttcgacaagaacctcag cggcaccatctcccacggcgagatctccaacctctccggcatcatggcca agaagttcttcatctgggtctccatcaccagcatggtggcgcacctggag agggggatgatcgagttccacgccggcatcatcactgaggacgtgccggc gtcgctcttccagaagatccccgtctgcggcaaaggcctcggcgagccgc tccgcggcgcggccggggtgatccgggagcttggcctggtccccgtcggc gaggtgtgagtggcttcgacgtccaaaagttctcaaacatgagttccctc cctgcttttgctgaaggttattatactactcctaccaatatgaactatgg tgggcaaatatttgcaccattctgggggaaaaaggagaaaagaaccctta ataattaaggtggggtgccaatttatgcggttaatgcctatttcaagttc ataaaacaaagttttggggttgggcctcggctctccaaggggggaccttt tttcaactcggggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.