Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF478938

[Submit comment/correction]

Sequence	BF478938
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC367213
wEST map position	BF478938
NCBI UniGene	Ta.441
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	1AS 2BS 5AL 6AL
Clone Library	Chinese Spring wheat drought stressed leaf cDNA library
Tissue	Leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2015_E04_J07ZS Chinese Spring wheat drought stressed leaf cDNA library Triticum aestivum cDNA clone WHE2015_E04_J07, mRNA sequence.
Other Name	WHE2015_E04_J07ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA036E1X
Clone	WHE2015_E04_J07
Probe	WHE2015_E04_J07
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton , Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.441.1.S1_at 502 WHE2AFFY TaAffx.92864.1.S1_at 76 WHE2AFFY TaAffx.99763.1.S1_at 64 WHE2AFFY TaAffx.65792.1.A1_at 50 WHE2AFFY
DNA	aagttcactggattgtctttgaatgttgtttcgcttatgcattatttatt gtactttgacatggattagcttggctttgcatctaggctctctcttgctt tcccaacaacttcagaagagatttttggatcaggtatcaggtccagaggc ggtggagagaagcaacatcatgatgctgctatatcttantggtcgggggt ggcacaatggtgatctgcttcttatctgttctaggtgtcactgtcatagc ttgcttggcataaccttccttcttttgatggttgtcaacacacatttaag tcacacacacaccatacaagatgcagagcctttggtatatgcagccgcac tcccttgccgccacctgctacttcaagtccgtcgacggccatgttggaaa ctagggcttctccatagcccgcctcaatctccacctcgccctccttgctg gtatacatgcat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.