GrainGenes Sequence Report: Ta.11307.1.S1_a_at
Sequence
BF474969
Contig
Ta.11307.1.S1_a_at Ta.11307.1.S1_x_at Ta.11307.3.S1_a_at NSFT03P2_Contig16985
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC292770
NCBI UniGene
Ta.37920
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_172514.1 PP2A-2 (protein phosphatase 2a-2); protein serine/threonine phosphatase [Arabidopsis thaliana]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat salt-stressed crown cDNA library
Tissue
Crown
Developmental Stage
Adult plant
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE2104_C02_F04ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2104_C02_F04, mRNA sequence.
Other Name
WHE2104_C02_F04ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA038E1X
Clone
WHE2104_C02_F04
Probe
BF474969
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
catgaacacgccctcctcctcctcctccccctcctccgtccccgcctccc
ccgatcccgtcgacagcccagcggccccgcccccctgctcccggcgggaa
cctagccccacggcggcgtaggcgtgccaggggaagcggcgcgcagcgac
gatgccgtcgcactctgatctggaccggcagatctcgcagctgcgggact
gcaagttcctgccggacgccgaggtcaaggccctctgcgagcaggccaag
gcgatccttatggaggagtggaacgtgcatcccgtgcgctgccccgtcac
cgtctgcggcgacatccacggccagttctacgacctcatcgagctcttcc
gcatcgggggcgacacccccgacacaaactaccttttcatgggcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.11307.1.S1_a_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
