GrainGenes Sequence Report: NSFT03P2_Contig14377
Sequence
BF474842
Contig
Ta.9338.2.S1_x_at NSFT03P2_Contig14377
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC291274
NCBI UniGene
Ta.18783
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001130156.1 hypothetical protein LOC100191250 [Zea mays]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat salt-stressed crown cDNA library
Tissue
Crown
Developmental Stage
Adult plant
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE2106_G09_M18ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2106_G09_M18, mRNA sequence.
Other Name
WHE2106_G09_M18ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA038E1X
Clone
WHE2106_G09_M18
Probe
[Wcl324ct1023cn1488] {SpCl-982} BF474842
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tgcctcatcgtcgcccctctccttcgccgtcggcagcgtttccctccgcc
gtcgccgccgccgccgccgccgcgcttccttcagcggctgccgctgctcc
tcgtcctcctccccagaaatggaggccggcgctggcacagctctgtaccc
cgcgcaccgatgcaaaaccatatacctggtgaggcatgcccagggtgttc
acaacgtggaaggcgagaaggattttgcagcatacaagtcacaggcgctg
cttgatgctcaacttacccctttgggctggagtcaagttgataccctgcg
agatcatgtgacaaaatgtggactagcaaaaaagattgagttggttattg
tttctcctctactcaggactatgcaaactgcagtaggggtctttggtggt
ggcagctatactgatggagcaagtgcatcaccattaatggtaga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: NSFT03P2_Contig14377
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
