Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF474552

[Submit comment/correction]

Sequence	BF474552
Contig	Ta.92.1.S1_s_at NSFT03P2_Contig18543
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC278882
wEST map position	BF474552
NCBI UniGene	Ta.54823
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Sucrose synthase type I'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	7AS 7BS
Clone Library	Wheat salt-stressed crown cDNA library
Tissue	Crown
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2102_D03_G06ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2102_D03_G06, mRNA sequence.
Other Name	WHE2102_D03_G06ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA038E1X
Clone	WHE2102_D03_G06
Probe	WHE2102_D03_G06
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.92.1.S1_s_at 969 WHE2AFFY [ Show all 11 ]
DNA	attaagcagcaaggccttgatataactcccaagatcctcattgtaaccag gttgttgcctgatgctgttggaaccacatgtggccagcggctggagaagg tcattggaactgagcacactgacattctccgtgttccattcagaactgag aatgggatcctccgtaagtggatctcgcgttttgatgtctggccgtacct ggagacatacaccgaggatgttgcaaacgaactcatgagggaaatgcaga ccaagcctgatctcatcattggtaactacagtgatggtaaccttgtggcc actctgcttgcacataaattgggagttacccagtgcaccattgcccatgc cttggagaaaaccaagtaccccaactcagacatatatttggacaaatttg acagccagtaccacttttcatgccaattcacagctgacctgattgccatg aaccacactgatttcatcattaccagcacattccaggaaatcgctggaag caaggatagcgtgggccaatatgagtctcacattgctttcacccttcctg atctgtaccggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.