Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF429144

[Submit comment/correction]

Sequence	BF429144
Contig	Ta.23142.1.S1_x_at Ta.23142.6.S1_x_at NSFT03P2_Contig18581
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC316115
NCBI UniGene	Ta.28610
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Low-molecular-weight glutenin storage protein'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat heat stressed spike cDNA library
Tissue	Whole spike
Developmental Stage	Spikes at 5, 10, 15 and 20 days after anthesis
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE1709_A04_A07ZS Wheat heat stressed spike cDNA library Triticum aestivum cDNA clone WHE1709_A04_A07, mRNA sequence.
Other Name	WHE1709_A04_A07ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA032E1X
Clone	WHE1709_A04_A07
Probe	BF429144
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Spikes at 5, 10, 15 and 20 days after anthesis were heat stressed under two conditions at Texas Tech University (D. Zhang in HT Nguyrn lab): (1) at 38 C for 4 hours and (2) 5 days of cyclic treatment of 38 C for 4 hours. Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	cgcaaatgttgcagcagagcagttgccatgtgatgcaacaacaatgttgc cagcagttgctgcaaatcccccagcaatcccgctatgaggcaatccgtgc tatcatctactccatcatcctgcaagaacaacaacaggttcagggttcca tccaaactcagcagcagcaaccccaagagttgggccaatgtgtttcccaa ccccaacagcagtcgcagcagcaactcgggcaacaacctcaacaacaaca attggcacagggtacctttttgcagccacaccagatagctcagcttgagg tgatgacttccattgcgctccgtaccctaccaacgatgtgccgtgtcaat gtgccgttgtatagaaccaccactagtgtgccattcggcgttggcgccgg agttggtgcctactgataaggaaaggtctctagtaatatatagttggatc accgttgtttagtcgatggatatgtcgatgcagcggtgacaaataaagtg tcacacaacgtcgtgtgtgacccgcccaaactagttgtttaaattctgaa ataaaatacaaataaagttgtatcaagacaatgttcatattggcattgtg tggatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.