GrainGenes Sequence Report: Ta.14343.1.S1_at
Sequence
BF429100
Contig
Ta.14343.1.S1_at NSFT03P2_Contig6062
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC334241
NCBI UniGene
Ta.14343
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001044698.1 Os01g0830700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat heat stressed spike cDNA library
Tissue
Whole spike
Developmental Stage
Spikes at 5, 10, 15 and 20 days after anthesis
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE1705-1708_E11_E11ZS Wheat heat stressed spike cDNA library Triticum aestivum cDNA clone WHE1705-1708_E11_E11, mRNA sequence.
Other Name
WHE1705-1708_E11_E11ZS  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli SOLR
DNA Library
TA032E1X
Clone
WHE1705-1708_E11_E11
Probe
[BF429100.1] {SpCl-420} BF429100
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Spikes at 5, 10, 15 and 20 days after anthesis were heat stressed under two conditions at Texas Tech University (D. Zhang in HT Nguyrn lab): (1) at 38 C for 4 hours and (2) 5 days of cyclic treatment of 38 C for 4 hours. Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
atgccgctggtgaactggcgcgggccgatatggctgggcacggactggga
catgttcaaggtggcgtccaacatcacccgggcggcggcgccgcgggtgc
ccatcaccttcgtggacatcaccaccatgtcggagcggcgcaaggacggg
cacacctccgtgcacaccatccggcagggccagatcctcacgccggagca
gcaggccgaccccggcacctacgccgactgcatccactggtgcctccccg
gcgtgcccgacatctggaacagcttgctctacaccaggatcatgtccagg
ccggacgccgccacggctgctctcacggccagatagatagatacatgttg
ggaatttctgtcgattcgaaaagttctttcttcttcttcttcttcttctt
ttttctttacattctttctggcct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.14343.1.S1_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
