Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF293891

[Submit comment/correction]

Sequence	BF293891
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Species	Triticum monococcum
Cultivar	DV92
Clone Library	Triticum monococcum vegetative apex cDNA library
Tissue	Vegetative shoot apex
Developmental Stage	Three weeks-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2253_C03_F05ZE Triticum monococcum vegetative apex cDNA library Triticum monococcum cDNA clone WHE2253_C03_F05, mRNA sequence.
Other Name	WHE2253_C03_F05ZE  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli XLOLR
Clone	WHE2253_C03_F05
Probe	BF293891
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene T3 primer. Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	cggcacgagctgggacgccgagttcgtcaaggtcgaccaggccaccctct tcgacctcatcctggctgcaaacttcctgaacatcaaggggctgctggac ctgacctgccagactgttgcagacatgatcaagggcaagaccccggagga gatccgcaagaccttcaacatcaagaacgacttcacgcccgaggaggagg aggagatccgcagggagaaccagtgggcctttgagtagaggcgtttgagt agaggagcatgtaggcgatgccgtccgcgctgggtgaacaatgcttagta ttcgtcatgtctgcgttttagcgcccttttttatgtcatcataatggttt catcgaacagcctgacgtatcgctcgtgtgaaaccctgaccctgtcgtct gt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.