Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF293856

[Submit comment/correction]

Sequence	BF293856
Contig	TaAffx.95561.1.S1_at NSFT03P2_Contig10573
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum turgidum
Keyword	EST
Germplasm	Langdon-16
Species	Triticum turgidum Triticum turgidum ssp. durum
Cultivar	Langdon-16
Clone Library	Triticum turgidum L. var. durum (durum wheat) whole plant cDNA library
Tissue	All tissues
Developmental Stage	Different growth stages
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2153_G07_N13ZS Triticum turgidum L. var. durum (durum wheat) whole plant cDNA library Triticum turgidum cDNA clone WHE2153_G07_N13, mRNA sequence.
Other Name	WHE2153_G07_N13ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TT039E1X
Clone	WHE2153_G07_N13
Probe	[Wcl896ct1766cn2358] {SpCl-268}
Remark	DB_xref: taxon:4571 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at North Dakota State University (Kianian, Otto, Simons). Tissues collected from seven-day etiolated seedling leaf, stem, root and seed; leaf from plant at fourth leaf stage; spike from pre-anthesis through 20 days after anthesis; flag leaf; leaf and stem tissue from tillers. and root. Total RNA and poly(A) RNA were prepared from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttgccttctttggcgacgcgccccccccttccctttttctgtagcacctt tgagctttatgctctcctcccattactttagcaagaaatctcaggacaaa tcctgcgggactttagttagagagagaccgatggcggcggcgagcgtcgg cggcggagcggcgccgttcgtgtggaagacgtaccggatggtggaggacc ccgggacggacggggtcatcgggtgggggaaggggaacaatagcttcgtc gtcgccgaccccttcgtcttctcgcagaccatgctccccgcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.