Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: oPt-15695_T

[Submit comment/correction]

Sequence	oPt-15695_T
Locus	oPt-15695_T
Species	Avena sativa
Reference	Tinker NA et al. (2009) New DArT markers for oat provide enhanced map coverage and global germplasm characterization BMC Genomics 10.
DNA	GTCCACGACGCTTTTTATATTTATCTTCTGTCAAGTCTGATTTGTAATGG AATGTTGAGCAATGTCCTGATTCTTT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.