Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: S5A_458285503

[Submit comment/correction]

Sequence	S5A_458285503
Species	Triticum aestivum
Probe	S5A_458285503
Remark	SNP locus reported by Aoun et al. is a single bp position on the IWGSC v1 (2018) reference map. The sequence for this locus was expanded to 101 bp with the SNP at position 51.
Reference	Aoun M et al. (2021) Genome-wide association mapping of the 'super-soft kernel texture in white winter wheat 134:2547-2559.
DNA	CACAGCTACAATCCAGGAGGTCCTCTCCTTTCTCAAATTGAGGGCAGCGT WAAAGCCCCTTGATCTCATCTACATACCAAATCAGGGAAGCTGCAGAGCC C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.