Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig18146

[Submit comment/correction]

Sequence	BF291740
Contig	NSFT03P2_Contig18146
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	BF291740
DB Remark	Locus Source: Aegilops speltoides
Keyword	EST
Species	Aegilops speltoides
Cultivar	F2 from 2-12-4-8-1-1-1-(1) x PI36909-12-811-(1 ) F2 from 2-12-4-8-1-1-1-(1) x PI36909-12-811-(1)
Chromosome	1BL 1DL 4BS
Clone Library	Aegilops speltoides anther cDNA library
Tissue	Anther
Developmental Stage	Premeiotic anthers
Data Source	genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	WHE2205_D12_G23ZS Aegilops speltoides anther cDNA library Aegilops speltoides cDNA clone WHE2205_D12_G23, mRNA sequence.
Other Name	WHE2205_D12_G23ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	AS040E1X
Clone	WHE2205_D12_G23
Probe	WHE2205_D12_G23
Remark	DB_xref: taxon:4573 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at the University of California, Davis (Akhunov). Premeiotic anthers were harvested, total RNA and poly(A) RNA were prepared, from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons , Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in a growth chamber at the University of California, Davis (Akhunov). Premeiotic anthers were harvested, total RNA and poly(A) RNA were prepared, from each tissue and then pooled, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.1842.1.S1_a_at 1078 WHE2AFFY [ Show all 7 ]
DNA	gacttctacatgggctgaaacctatgatgtccatgtcctcggcatcgatc tttccatcaacatggtttcgttcgcgatcgagcgtgccatcgggcgctcg tgctcggttgagtttgaggttgctgactgcaccaccaaggaatacgcaga gaacacgtttgatgtcatctacagccgtgacaccatcctccacattcaag acaaacctgccctgttcagaaacttcttcaagtggctcaagcctgggggc aaagtgctgatcagtgactactgcaggagccctgggacaccatcagagga atttgctgcgtacatcaagcagagaggctatgacctccatgatgtgaaga cctatggaaagatgcttgaggatgccggtttccatgacgtcgttgccgaa gaccgcaccgaccagttcctgagggtcctggagagggagctgggcgagac cgagaagaacaggaggccttcctggcggacttcacccaggaggactacga cgacatcgtgaccggctggagcgcgaagctgaagcggagctccgccggcg agcagaagtgggggctgttcatcgcgaccaagtgatctggccgccgagca gcgacgccatgcgacgcgatgatccggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.