Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AX-94894712

[Submit comment/correction]

Sequence	AX-94894712
Locus	AX-94894712
Species	Triticum aestivum
Other Name	BA00436449  [ wEST-mySQL (obsolete) ]
Probe	AX-94894712 BA00436449
Reference	Allen AM et al. (2017) Characterization of a Wheat Breeders' Array suitable for high-throughput SNP genotyping of global accessions of hexaploid bread wheat (Triticum aestivum) Plant Biotechnology Journal 15:390-401.
Type	SNP
DNA	GTCATCGTCACCGGCGCCATGGCGCAGTACATCGGSACCCTCAAGTACTA CAGCGGCGACCTGCCCATGGC

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.