Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF202012

[Submit comment/correction]

Sequence	BF202012
Contig	Ta.1342.1.S1_s_at Ta.1342.2.S1_x_at NSFT03P2_Contig17967
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC311499
NCBI UniGene	Ta.54244
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001058751.1 Os07g0114300 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat pre-anthesis spike cDNA library
Tissue	Spike before anthesis
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE1759-1762_i18_i18zS Wheat pre-anthesis spike cDNA library Triticum aestivum cDNA clone WHE1759-1762_i18_i18, mRNA sequence.
Other Name	WHE1759-1762_i18_i18zS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA019E1X
Clone	WHE1759-1762_i18_i18
Probe	BF202012
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	gtctcgtctcgtctaggaataacacccatgggcggcggcagacgcgcaca agtccaagatggcgagggagaggaacctccagaagctgaagggcggcaag gggagccacctcgaggccaacaagaaggccatgaacatccagtgcaagat atgcatgcagactttcatctgcaccacctctgaagcaaagtgcaaggagc atgccgaggcaaagcatccgaagagcgagctcgtccagtgcttccctcac ctcaagcagtgatatctgcccaatcagacagagagagagataaaagagag agagagagagaagctgtcataatccacctactattatcatgttccgcaat gactgattgttgacctaagcttggggtctgaactcggtgtgctgctgtcc cggctgctttggttgtgtgcccatctactatgtaatcgtcctctatcagc ctgttgtgctacattatcttaatcctctgtggatttgctcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.