Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig18646

[Submit comment/correction]

Sequence	BE637485
Contig	NSFT03P2_Contig18646
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC306284
wEST map position	BE637485
NCBI UniGene	Ta.69
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Clone wdk3c.pk018.g1:fis, full insert mRNA sequence'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	5AS 5BS 5DS
Clone Library	Wheat 20-45 DAP spike cDNA library
Tissue	Spike and seed
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0859_D03_G05ZS Wheat 20-45 DAP spike cDNA library Triticum aestivum cDNA clone WHE0859_D03_G05, mRNA sequence.
Other Name	WHE0859_D03_G05ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA017E1X
Clone	WHE0859_D03_G05
Probe	MAG701 WHE0859_D03_G05
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 20 DAP and seeds at 30 to 45 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 20 DAP and seeds at 30 to 45 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.69.2.S1_x_at 739 WHE2AFFY Ta.69.2.S1_x_at 446 WHE2AFFY Ta.840.1.S1_at 593 WHE2AFFY Ta.840.1.S1_at 343 WHE2AFFY Ta.28689.3.S1_a_at 56 WHE2AFFY
DNA	tcttcctcctagctttccttgctctggtagtgagcactgctattgcgcaa tatgcagaagttcccagcccagctgcgcaagctcccaccgcggatggttt tggggaatgggttgcgatagcgcctagtgcgagtggttctgagaattgcg aggaagagcagccaaaggtagactcttgtagcgattatgttatggatcgg tgtgtgatgaaggatatgccgctctcttggttctttcctcggacttgggg gaagagaagttgtgaggaggtccgaaaccagtgttgtaagcaattgaggc aaacgacgtcgcgttgccgttgcaaggctatatggacatcaatccaaggc gatctaagtggcttcaagggcct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.