Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.681.2.S1_a_at

[Submit comment/correction]

Sequence	BE591944
Contig	Ta.681.1.S1_at Ta.681.1.S1_x_at Ta.681.2.S1_a_at NSFT03P2_Contig17434
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC283801
NCBI UniGene	Ta.54292
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Ferritin 1A'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat heat stressed flag leaf cDNA library
Tissue	Flag leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE1651-1654_G07_G07ZS Wheat heat stressed flag leaf cDNA library Triticum aestivum cDNA clone WHE1651-1654_G07_G07, mRNA sequence.
Other Name	WHE1651-1654_G07_G07ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA031E1X
Clone	WHE1651-1654_G07_G07
Probe	[Wcl12ct69cn118] {SpCl-555} BE591944
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants at full-tillering stage were heat stressed under four conditions: (1) 38 C for 2 hours, (2) 38 C for 4 hours, (3) 2 days of cyclic treatment of 38 C for 2 hours, (4) 2 days of cyclic treatment of 38 C for 4 hours, at Texas Tech University (D Zhang in Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	gcaagcgcgccgccgccgttcgggttcgagatgttgcctagggttgcgcc gtctccggccaccgccgccgccgccgccgcagcggttggccagctctccg gggcggggctcaccgccggttcggtgaggctgccgggggccctgccgtct gcggcagggtcggcggtctgctgcagggccgcggcgaaggggaaggaggt gctcancggcgtgatgttccagccgttcgaggagctcaagggggagctgt ccctcgtgccgcagggcaaggaccagtcgctcgccaggcacaagttcgtc gacgagtgcgaggccgccctcaacgagcagatcaatgtggagtataatgc ctcgtacgcgtatcactccctcttcacctacttcaaccgcgacaacgttg ctctcaagggatttgccaagttcttcaaggaatcaagcgatgaggagagg gggcac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.