Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE587111

[Submit comment/correction]

Sequence	BE587111
Contig	NSFT03P2_Contig8372
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC4116
DB Remark	Locus Source: Secale cereale (rye)
Keyword	EST
Germplasm	Blanco
Species	Secale cereale
Cultivar	Blanco
Clone Library	Secale cereale aluminum-stressed root tip cDNA library
Tissue	Root tip
Developmental Stage	Seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	WHE0517_E11_I21ZR Secale cereale aluminum-stressed root tip cDNA library Secale cereale cDNA clone WHE0517_E11_I21, mRNA sequence.
Other Name	WHE0517_E11_I21ZR  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli DH12S
DNA Library	SC010XXX
Clone	WHE0517_E11_I21
Probe	SCM11
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: M13 reversed primer. Note: Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Seeds were germinated aseptically on filter paper and transferred to a hydroponic growth system in a growth chamber when the primary root was 1 cm in length. After a 2-day establishment period, seedlings were subjected to a 5 ppm aluminum stress prior to tissue harvest. Plants were grown in an environmental chamber. The tissue, total RNA, and poly(A) RNA were prepared, and a cDNA library was made (Butler and Gustafson) at University of Missouri , Columbia. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ). Note: Vector: pSPORT1; Site_1: SalI; Site_2: NotI; Seeds were germinated aseptically on filter paper and transferred to a hydroponic growth system in a growth chamber when the primary root was 1 cm in length. After a 2-day establishment period, seedlings were subjected to a 5 ppm aluminum stress prior to tissue harvest. Plants were grown in an environmental chamber. The tissue, total RNA, and poly(A) RNA were prepared, and a cDNA library was made (Butler and Gustafson) at University of Missouri, Columbia. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ccacgcgtccggcatcgtctcgtctcgccggggaatcaacagccatgggc ggaggcaacgcgcagaagtccaagatggcgagggagaggaacctcgagaa gctgaagggcggcaaggggagccagctcgaggccaacaagaaggccatga acatccagtgcaagatatgcatgcagactttcatctgcaccacctctgaa gcaaagtgcaaggagcatgccgaggcgaagcatccgaagagcgacctcgt ccagtgcttcccccacctcaagcagtgatatctgcctaatcagacggaga gaaagataaaagagagagagagaagctgtcataatccacctagtattatc atgttcccccatgactggttgttgacctaagcttgggtctgaactctggt gtgctgctgtcccagctgctttggttgtgtgcccatctactatgtaatcg tcctctatcagcctgttgtgctacaatatcttaatcctctgtgga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.