Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE517627

[Submit comment/correction]

Sequence	BE517627
Contig	Ta.1532.1.S1_a_at NSFT03P2_Contig18796
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC305746
wEST map position	BE517627
NCBI UniGene	Ta.54072
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Eukaryotic translation initiation factor 5A3'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2AL 2BL 2DL 7BL
Clone Library	Wheat vernalized crown cDNA library
Tissue	Crown tissue of seedling
Developmental Stage	Five-week old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0801_H04_O07ZS Wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0801_H04_O07, mRNA sequence.
Other Name	WHE0801_H04_O07ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA016E1X
Clone	WHE0801_H04_O07
Probe	WHE0801_H04_O07
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.1532.1.S1_a_at 753 WHE2AFFY [ Show all 24 ]
DNA	gctgccgctgcgtctcgtctccaccaccccacttgcccccggactcagga ggatcgtcggagatgtcggacaccgatgagcaccacttcgagtccaaggc cgactccggcgcctccaagacctacccgcagcaggctggcgccatccgca agggtggacacatcgtcatcaaggcccgtccctgcaaggttgttgaggtc tccacctccaagactgggaagcatggtcacgcaaagtgtcactttgttgc cattgacatctttaatggaaagaagcttgaggatatcgttccttcatccc acaactgtgacgtcccccatgttgaccgccaagattatcagctgattgac ataactgatgatggatatgtcagccttctcactgagagtggtaacactaa ggatgacctgaagcttcccactgatgatgttctgcttggccagatcaaga ctggatttgctgatggcaaggacctgatcctgtctgtgatgtccgccatg ggtgaagaacagatctgcgctgtgaaggaaatcggtggtggcaagtaagc agctgtgcgtggttgcctacctgcgatacttggtatctagtgcttctggg tgtttgagatacacatacataggcatcaagatatctgttgggtgaaac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.