GrainGenes Sequence Report: NSFT03P2_Contig16091
Sequence
BE517409
Contig
Ta.28306.2.S1_at NSFT03P2_Contig16091
Tracefile
[ Download ] [ View ]
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC295354
NCBI UniGene
Ta.38753
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001063584.1 Os09g0502000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
BREVOR
Species
Triticum aestivum
Cultivar
Brevor (soft, white, winter, common wheat)
Clone Library
Wheat ABA-treated embryo cDNA library
Tissue
Seed embryo
Developmental Stage
Mature dormant seeds
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
WHE0626_G06_M12ZA Wheat ABA-treated embryo cDNA library Triticum aestivum cDNA clone WHE0626_G06_M12, mRNA sequence.
Other Name
WHE0626_G06_M12ZA  [ wEST-mySQL (obsolete) ]
Strain
lab_host E. coli DH12S
DNA Library
TA012XXX
Clone
WHE0626_G06_M12
Probe
[Wcl191ct794cn1203] {SpCl-206} BE517409
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Clontech Matchmaker 3' AD primer. Note: Vector: pGAD10; Site_1: EcoRI; Site_2: XhoI; Embryos were cut from mature, dormant seeds and imbibed in 25 microM ABA (abscisic acid) in 5 mM Mes buffer, pH 5.7, for 12 hr at 22 C. The tissue, total RNA, and poly(A) RNA were prepared by Steven Verhey in M.K. Walker-Simmons's lab (USDA-ARS, Washington State Univ., Pullman, Washington 99164-6420. A cDNA library was made by Clontech using a combination of random and oligo dT primers. Library was plated and archived by Russell Johnson (Colby College, ME/Walker-Simmons' lab). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
gcggccgcgtcgacgccgccgccgccgccgcccgcccgcccgcccgctcc
gccgcagttctcccaagatggcggtgcctctgctgaagaaggcgatcgtg
aagaagagggtgaagcacttcaagagggcgcacagcgaccgctacatcgg
cctcaagcaaagctggcgtaggccaaagggtatcgactcccgcgtcaggc
ggaagttcaagggatgcaccttgatgcccaacatcgggtatggttcagac
aagaagaccaggcactacctgcccaacaagttcaagaagtttgttgtcca
caatgtctctgagctggagctgcttatgatgcacaacaggacctactgtg
ctgagatcgcacacaacgtgtccacacagaagcgcaaggcgatcgttgag
cgtgctgcgcagctcgacgtcgtggtcaccaacaagcttgccaggctccg
cagccaggaggacgagtaaagcattatctagtcaactagtcttggttgct
acctttgtagtagacattacatccctgtttgagaagaaaaatactgccat
tttgcaagatttcatgtatggaccgcctttttggtgtgagcaatggtgaa
atgtactatctggtcgacgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: NSFT03P2_Contig16091
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
