Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AE021857

[Submit comment/correction]

Sequence	AE021857
Germplasm	BYU132 (oat)
Species	Avena erithiana
Probe	AE021857
Reference	Maughan PJ et al. (2019) Genomic insights from the first chromosome-scale assemblies of oat (Avena spp.) diploid species BMC Biology 17.
DNA	GGAGAGATGGACGAGCGGTTGAAGGCGTAGCATTGGAATTACTATGTAGC TTTTGTTTACAGAGGGTTCGAATCCCTATCTTTCCG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.