Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.7436.1.A1_at

[Submit comment/correction]

Sequence	BE515993
Contig	Ta.7436.1.A1_at Ta.7436.1.A1_x_at NSFT03P2_Contig14570
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC359340
NCBI UniGene	Ta.18720
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Clone wem1c.pk001.g11:fis, full insert mRNA sequence'
Keyword	EST
Germplasm	BREVOR
Species	Triticum aestivum
Cultivar	Brevor (soft, white, winter, common wheat)
Clone Library	Wheat ABA-treated embryo cDNA library
Tissue	Seed embryo
Developmental Stage	Mature dormant seeds
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0607_F01_L01ZA Wheat ABA-treated embryo cDNA library Triticum aestivum cDNA clone WHE0607_F01_L01, mRNA sequence.
Other Name	WHE0607_F01_L01ZA  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli DH12S
DNA Library	TA012XXX
Clone	WHE0607_F01_L01
Probe	CFE33 CFE34
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Clontech Matchmaker 3' AD primer. Note: Vector: pGAD10; Site_1: EcoRI; Site_2: XhoI; Embryos were cut from mature, dormant seeds and imbibed in 25 microM ABA (abscisic acid) in 5 mM Mes buffer, pH 5.7, for 12 hr at 22 C. The tissue, total RNA, and poly(A) RNA were prepared by Steven Verhey in M.K. Walker-Simmons's lab (USDA-ARS, Washington State Univ., Pullman, Washington 99164-6420. A cDNA library was made by Clontech using a combination of random and oligo dT primers. Library was plated and archived by Russell Johnson (Colby College, ME/Walker-Simmons' lab). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	cgaattcgcggccgcgtcgacttaattactttattacaattgtaggagga gcaacctccttttgaagcaaatataatagtagcaggcagcggtacaagca tgagatcatatgtggctgagaactcgatccatggtccatacagtaccgta gcctagttcgatgacaagcagtagttcaaaggatactaccccacacacac acacacagagacacgagcacacatgtaaagtttagcatgcaactagcaag agcgatgataaattatgaagcaaataacgtatacgactagctatagagta ctagtcaatggatggatcgtagatcatgcatgcgagctggtgtacgcatg catgcacgtacgtacgtatagtggatgcctgctgtggacgatggatctct cgggtcttctcttctagcgggggcactggaagccggaggggacgttcttg ccgcagtagttgacgaggaggctgaggtcgatgggcacgttgaggttgat gcccaggatgttggccttgagcgccgtgcagaggcacaccgccgcctcca ggtcggcgaggccctggatcagcgagcagcacggctgcttcggcggcgtc cccagctgcaggttgatcagcccgttgagcacgttggcgcacacgcccag cttcagcgcgtcgatggg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.